10.5061/DRYAD.PK0P2NGJD
Vu, Duc Phuong
University of Kaiserslautern
Martins Rodrigues, Cristina
University of Kaiserslautern
Jung, Benjamin
University of Kaiserslautern
Meissner, Garvin
University of Kaiserslautern
Klemens, Patrick A.W.
University of Kaiserslautern
Holtgräwe, Daniela
Bielefeld University
Fürtauer, Lisa
0000-0001-5248-4105
Ludwig Maximilian University of Munich
Nägele, Thomas
Ludwig Maximilian University of Munich
Nieberl, Petra
Nuremberg Hospital
Pommerrenig, Benjamin
0000-0002-7522-7942
University of Kaiserslautern
Neuhaus, Ekkehard H.
University of Kaiserslautern
Vacuolar sucrose homeostasis is critical for development, seed properties
and survival of dark phases of Arabidopsis
Dryad
dataset
2020
Arabidopsis thaliana
Beta vulgaris
darkness
Plant development
sucrose compartmentation
sugar
vacuolar invertase
LMUexcellence Junior Researcher Fund (Nägele lab)*
Deutsche Forschungsgemeinschaft
https://ror.org/018mejw64
IRTG1831
Deutsche Forschungsgemeinschaft
https://ror.org/018mejw64
TRR175
LMUexcellence Junior Researcher Fund (Nägele lab)
2021-04-23T00:00:00Z
2021-04-23T00:00:00Z
en
3065365 bytes
4
CC0 1.0 Universal (CC0 1.0) Public Domain Dedication
Although we know that most of the cellular sucrose is present in the
cytosol and vacuole, our knowledge on the impact of this sucrose
compartmentation on plant properties is still fragmentary. Here we
attempted to alter the intracellular sucrose compartmentation of
Arabidopsis mesophyll cells by either, overexpression of the vacuolar
sucrose loader BvTST2.1 or by generation of mutants with decreased
vacuolar invertase activity (amiR vi1-2). Surprisingly, BvTST2.1
overexpression led to increased monosaccharide levels in leaves, while
sucrose remained constant. Latter observation allows the conclusion, that
vacuolar invertase activity in mesophyll vacuoles exceeds sucrose uptake
in Arabidopsis, which gained independent support by analyses on tobacco
leaves transiently overexpressing BvTST2.1 and the invertase inhibitor
NbVIF. However, we observed strongly increased sucrose levels in leaf
extracts from independent amiR vi1-2 lines and non‑aqueous fractionations
confirmed that sucrose accumulation in corresponding vacuoles. amiR vi1-2
lines exhibited impaired early development and decreased weight of seeds.
When germinated in the dark, mutant seedlings showed problems to convert
sucrose into monosaccharides. Cold temperatures induced marked
downregulation of the expression of both VI genes, while frost tolerance
of amiR vi1-2 mutants was similar to WT indicating that increased vacuolar
sucrose levels fully compensate for low monosaccharide concentrations.
Materials and methods Plant material and growth conditions Nicotiana
benthamiana, Arabidopsis thaliana (ecotype Columbia-0) and corresponding
Arabidopsis mutants were cultivated in a growth chamber (Weiss-Gallenkamp,
Heidelberg, Gemany) on standardized soil (ED-73; Patzer;
www.einheitserde.de), at a constant temperature of 22°C and a light
intensity of 120 µmol quanta m-2 s-1 (µE). Plant cultivation was carried
out under short day conditions,10 h light, 14 h darkness (standard
conditions). For cold experiments, plants were grown for four weeks under
standard conditions and subsequently acclimated to cold temperature for
three days at 4°C (all other conditions were kept constant). For
etiolation growth analyses, seeds were stratified for 24 h at 4°C, and
cultivated in darkness for seven days on water soaked blotting paper. For
seed analyses, plants were transferred after cultivation for four weeks at
standard conditions to long day conditions (22°C and 200 µE, 16 h light
per day). For dark recovery experiments, 4-week old plants grown under
standard conditions were darkened for five days, followed by recovery for
further 7 days under standard conditions. Generation of mutants For
transient transformation of Nicotiana benthamiana leaf mesophyll cells the
Agrobacterium infiltration method was performed according to an
established method (Jung et al., 2015). For generation of VI1-2 double
knock down mutants, we followed an established protocol for gene silencing
by artificial microRNA (amiRNA) (Schwab et al., 2006). With the web based
amiRNA designer tool program (http://wmd3.weigelworld.org) an amiRNA,
which targets VI1 (At1g62660) and VI2 (At1g12240) simultaneously, was
designed. The sequence TAAGGATGAATAAAAGCACGG was used for generation of
primers including the Gateway™ compatible sequences attP1 and attP2 to
engineer the amiRNA fragment. The primer sequences are listed in Table S1.
Subsequently, the fragment was sub-cloned via BP reaction into the
Gateway™ entry vector pDONR/Zeo and via LR reaction into the destination
vector pK2GW7, which contains a 35S-CaMV promotor. For generation of
stably transformed Arabidopsis mutant plants, Agrobacterium-mediated
transformation using floral dip was performed (Clough and Bent, 1998).
VI1-2 double knock-down mutants were selected by screening for the lowest
remaining VI1 and VI2 transcript levels via qRT-PCR leading to the two
independent lines no. 4 and 5. cDNA synthesis, qRT-PCR and RNA gel‐blot
hybridization RNA was isolated from 50 mg of frozen, fine ground plant
material with the NucleoSpin RNA Plant Kit (Macherey-Nagel, Düren,
Germany), according to the manufacturer’s protocol. For cDNA synthesis,
RNA was transcribed into cDNA with the qScript cDNA Synthesis Kit
(Quantabio, Beverly, MA, USA). The primers used for gene expression
analysis by qRT-PCR are listed in Table S2. NbAct, AtPP2A and AtSAND were
used as reference genes for transcript normalization. Alternatively, gene
expression was analyzed by RNA gel‐blot hybridization. Acidic invertase
activity assay The enzyme assay was performed as described by (Tamoi et
al., 2010) with slight modifications. 100 mg of frozen and fine ground
plant material were homogenized with 1 ml of ice cold 200 mM Hepes/HCl (pH
5.0), 1 mM EDTA, 1 mM PMSF on a vortex mixer for 20 sec. The samples were
incubated for 20 min on ice prior to further mixing with a vortex mixer
for 20 sec. Subsequently, samples were centrifuged at 20.000 g for 10 min
at 4°C and the supernatant was transferred into a new reaction tube. The
rate of sucrose hydrolysis was quantified spectrophotometrically at 22°C
using a NADP-coupled enzymatic test (Stitt et al., 1989). For this, 15 µl
of enzyme extract were added to 190 µl 200 mM Hepes/HCl (pH 5.0), 10.5 mM
MgCl2, 2.1 mM ATP, 0.8 mM NADP, 0.5 U Glucose-6-Phosphate Dehydrogenase,
0.18 U Hexokinase and 0.48 U Phosphoglucose Isomerase. To start the enzyme
reaction, 5 µl of 200 mM sucrose solution were added to the sample.
Metabolite quantification For sugar extraction, we added 400 µl of 80% of
ethanol to 100 mg of frozen, fine grounded plant material, mixed and
incubated for 30 min at 80°C, in a thermomixer at 500 rpm. After
centrifugation at 16000 g (10 min at 4°C) the supernatant was used for
sugar quantification using a NADP-coupled enzymatic test (Stitt et al.,
1989). Non-aqueous fractionation Subcellular sugar distribution of
sugars in leaves was determined by non-aqueous fractionation of 4-week old
plants. To this end, 15 mg of freeze-dried and fine grounded plant
material was used and processed as described previously (Fürtauer et al.,
2016). Acid phosphatase served as vacuolar marker, UGPase activity served
as a cytosolic marker and alkaline pyrophosphatase served as chloroplast
marker. For sugar quantification, a NADP-coupled enzymatic test was
performed (Stitt et al., 1989) and subcellular metabolite distribution was
calculated using an established algorithm (Fürtauer et al., 2016). Seed
analyses Lipid quantification was performed according to a routine
protocol (Reiser et al., 2004) with slight modifications. 0.1 g of mature,
air-dried seeds were homogenized in a mortar and liquid nitrogen.
Subsequently, 1.5 mL of isopropanol was added and the sample was further
homogenized. The suspension was transferred into a 1.5 mL-reaction tube
and incubated for 12 h at 4°C and 100 rpm. Subsequently, samples were
centrifuged at 13000 g for 10 min and the supernatant was transferred into
a pre-weighed 1.5-mL reaction tube. Tubes were incubated at 60°C for 12 h
to completely evaporate the isopropanol. Total lipid content was
quantified gravimetrically. For determination of seed weight, 1000 mature
and air-dried seeds were counted and their weight was quantified
gravimetrically. Electrical conductivity The frost tolerance, as
measured by frost induced release of ions from leaf sample, of wild-type
and mutant, was quantified by electrical conductivity assays, described
earlier (Klemens et al., 2014).