10.5061/DRYAD.NZS7H44QJ
Armstrong, Ellie
0000-0001-7107-6318
Stanford University
Perez-Lamarque, Benoît
0000-0001-7112-7197
Institut de Biologie de l'École Normale Supérieure
Bi, Ke
University of California, Berkeley
Becking, Leontine
Wageningen University & Research
Lim, Jun
Nanyang Technological University
Linderoth, Tyler
University of Cambridge
Gillespie, Rosemary
University of California, Berkeley
Krehenwinkel, Henrik
University of Trier
ddRAD of Hawaiian Ariamnes spiders
Dryad
dataset
2020
2021-11-22T00:00:00Z
2021-11-22T00:00:00Z
en
17555229276 bytes
8
CC0 1.0 Universal (CC0 1.0) Public Domain Dedication
The diversification of a host organism can be influenced by both the
external environment and its assemblage of microbes. Here, we use a young
lineage of spiders, coupled with a chronologically arranged series of
volcanic mountains, to determine the evolutionary history of a host and
its associated microbial communities, altogether forming the “holobiont”.
Using the stick spider Ariamnes waikula (Araneae, Theridiidae) on the
island of Hawaiʻi, and outgroup taxa on older islands, we tested whether
the host spiders and their microbial constituents have responded in
similar ways to the dynamic abiotic environment of the volcanic
archipelago. The expectation was that each component of the holobiont (the
spider hosts, intracellular endosymbionts, and gut microbiota) should show
a similar pattern of sequential colonization from older to younger
volcanoes. In order to investigate this, we generated ddRAD data for the
host spiders and 16S rRNA gene amplicon data from their microbiota.
Results showed that the host A. waikula is strongly structured by
isolation, suggesting sequential colonization from older to younger
volcanoes. The endosymbiont communities were markedly different between
Ariamnes species on different islands, but more homogenized among A.
waikula populations. In contrast, the gut microbiota was largely conserved
across all populations and species, and probably mostly environmentally
derived. Our results highlight the different evolutionary trajectories of
the distinct components of the holobiont, showing the necessity of
understanding the interplay between components in order to assess any role
of the microbial communities in host diversification.
To examine the population structure of the spider host, we used ddRAD to
obtain reduced representation genome-wide SNP data. Genomic DNA was
extracted from spider legs with several modifications to the Qiagen DNeasy
kit protocol. Legs were first removed from each specimen using sterile
tweezers so that the abdomen remained intact for the microbial DNA
analysis. DNA was then extracted by placing the tissue in Proteinase K and
lysis buffer and grinding them with a sterile pestle to break up the
exoskeleton. We then added 4uL RNase A (100 mg/ml) and incubated the
extractions for two minutes at room temperature. Tubes with tissue and
extraction solution were then placed overnight in a heat block at 56°C.
The remainder of the extraction protocol was performed following the
manufacturer’s instructions. We built ddRAD libraries following an adapted
protocol of Peterson et al. (2012) (Saarman & Pogson, 2015; see
Maas et al. 2018 for protocol optimization steps). Briefly, we started the
ddRAD protocol with a total of 100 nanograms of DNA per sample. The DNA
was digested using SphI‐HF (rare‐cutting) and MlucI (frequent‐cutting)
restriction enzymes. We assessed fragmentation with a Bioanalyzer High
Sensitivity chip (Agilent). We multiplexed 15-20 individuals per library
for a total of eight ddRAD libraries. We used a Sage Science Pippen Prep
to size select 451-551bp (including internal adapters) fragments, and
confirmed the sizes using a Bioanalyzer. Ten indexing polymerase chain
reaction cycles (PCRs) were run on each library to enrich for
double‐digested fragments and to incorporate a unique external index for
each library pool. The eight libraries were sequenced using 100bp
paired-end sequencing on one Illumina HiSeq 2500 lane at the Vincent J.
Coates Genomic Sequencing Facility at UC Berkeley. To characterize the
microbial community within the A. waikula hosts, 71 individuals from eight
populations of three Hawaiian Islands were selected for analysis. We
focused on the mid and hindgut, both located in the spider’s opisthosoma.
The preservation in ethanol led to considerable shrinkage of the
opisthosoma and thus did not allow us to separately dissect out the gut.
Instead, we used the whole opisthosoma to extract DNA. Specimens which did
not have the opisthosoma intact were not used. The digestive tract
comprises the majority of the opisthosoma’s cavity. In addition, it
contains silk glands, the heart, lungs, and gonads. The opisthosoma was
removed with a sterile razor blade and then washed in ethanol to remove
external bacteria (Hammer et al. 2015). We considered it to be
representative of the “gut microbiota”, even if it technically consists of
the “opisthosoma microbiota”, but previous studies have shown that the gut
microbiota dominates in the opisthosoma (Sheffer et al. 2020, Kennedy et
al. 2020). The tissue was then transferred into lysis buffer and finely
ground with a sterile pestle. DNA was extracted using the Gentra Puregene
Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s
protocol. Spider abdominal tissue can contain PCR inhibitors (Schrader et
al. 2012), thus we cleaned the DNA extract with 0.9X AmPure Beads XP. We
next amplified a ~300 bp fragment of the V1-V2 region of the bacterial 16S
rRNA using the Qiagen Multiplex PCR kit according to the manufacturer’s
protocols and using the primer pair MS-27F (AGAGTTTGATCCTGGCTCAG) and
MS-338R (TGCTGCCTCCCGTAGGAGT) (Gibson et al. 2014). PCRs were run with
20ng of template DNA and 30 cycles at an annealing temperature of 55°C.
PCR products were separated from leftover primer by 1X AmPure Beads XP. A
six-cycle indexing PCR was performed on the cleaned products, adding dual
indexes to every sample using the Qiagen Multiplex PCR kit. Indexing was
performed according to (Lange et al. 2014). The dual indexed libraries
were isolated from leftover primer as described above, quantified using a
Qubit fluorometer, and pooled in equal amounts into a single tube. The
library was sequenced on an Illumina MiSeq using V3 chemistry and 300 bp
paired reads. We also performed blank extraction controls and negative PCR
controls (without DNA template) in order to discard contaminants from our
final dataset.