10.5061/DRYAD.MSBCC2FW6
Walker, Joanne
Yale University
Yao, Gang-Qing
Yale University
Siu, Edwin
0000-0003-1046-2279
Yale University
Zhu, Meiling
Yale University
Simpson, Christine
0000-0001-7887-5577
Yale University
Insogna, Karl
Yale University
An unanticipated role for sphingosine kinase-2 in bone and in the anabolic
effect of parathyroid hormone: Supplementary figures
Dryad
dataset
2021
FOS: Medical and health sciences
Sphingosine-1-phosphate (S1P)
Sphingosine kinases
Osteoclasts
Osteoblasts
parathyroid hormone (PTH)
bone anabolism
National Institute of Arthritis and Musculoskeletal and Skin Diseases
https://ror.org/006zn3t30
AR060322
2021-03-24T00:00:00Z
2021-03-24T00:00:00Z
en
https://doi.org/10.1210/endocr/bqab042
1219608 bytes
6
CC0 1.0 Universal (CC0 1.0) Public Domain Dedication
Sphingosine-1-phosphate (S1P) is an anabolic clastokine. SPHK is the
rate-limiting enzyme in S1P production and has two isoforms. To evaluate
the roles of SPHK1 and SPHK2 in bone, we examined the skeletal phenotype
of mice with selective deletion of SPHK1 in osteoclasts (SPHK1-Oc-/-) and
mice in which the SPHK2 gene was deleted in all tissues (SPHK2-/-).
SPHK1-Oc-/- had normal bone mass. By contrast, SPHK2-/- female mice had a
14% lower spinal BMD (p<0.01) and males a 22% lower BMD at the same
site (p<0.001). SPHK2-/- and control mice were subsequently treated
either with daily PTH(1-34) or vehicle for 29 days. The response to PTH
was significantly attenuated in the SPHK2-/-mice. The mean femoral BV/TV
increased by 24.8% in the PTH-treated female control animals vs 10.6% in
the vehicle-treated female controls (p <0.01). In contrast, in the
SPHK2-/- female mice the difference in femoral trabecular BV/TV at the end
of treatment was not significant (20.5 vs.13.3%, PTH vs. vehicle, p = NS).
The anabolic response to PTH was significantly attenuated in the spine of
male SPHK2-/- mice (29.7% vs. 23.1%, PTH vs. vehicle, in controls, p
<0.05; 26.9% vs. 19.5% PTH vs. vehicle in SPHK2-/- mice, p = NS).
The spine responded normally in the SPHK2-/- female mice. Interestingly,
suppression of Sost was blunted in the SPHK2-/- mice when those animals
were treated with an anabolic PTH regimen. We conclude that SPHK2 has an
important role in mediating both normal bone remodeling and the anabolic
response to PTH.
Micro-CT: Mice in which SPHK1 was selectively deleted in osteoclasts
(SPHK1-OC-/-) mice were generated by crossing cathepsin Kcre+/ mice with
SPHK1flox/flox mice and then back crossing their cre+ offspring to the
SPHK1flox/flox mice followed by appropriate genotyping. SPHK1flox/flox
littermates lacking Cathepsin Kcre+/ matched for sex and weight were used
controls. Femurs and spines were collected, femurs were stripped of soft
tissue and both femur and spine were stored in 70% ethanol at 4 °C for
subsequent microcomputed tomographic analyses (μCT). Data were acquired
using a Scanco μCT-35 instrument (Scanco, Brutissellen, Switzerland) as
previously described (13). Briefly, volumetric regions for trabecular
analyses, selected within the endosteal borders of the distal femoral
metaphysis to include the secondary spongiosa located 1 mm from the growth
plate and extending 1 mm proximally, were scanned at 12 μm resolution.
Cortical morphometry was quantified and averaged volumetrically through 50
serial cross-sections (600 μm) extending distally from the diaphyseal
mid-point between proximal and distal growth plates. We used a customized
thresholding technique (Scanco, Brutissellen, Switzerland) that provided
the best segmentation of the bone tissue. Both 2- and 3-D μCT data
included bone volume to total volume fraction (BV/TV), trabecular number
(Tb.N), thickness (Tb.Th), spacing (Tb.Sp), and connectivity density
(Conn.D). Cortical thickness averaged for both cortices (Cor.Th) was also
quantified. PTH-induced changes in sCSF1 in SPHK2-/-‑ animals: Twenty
SPHK2-/- animals were treated with either vehicle (n=10) or (1-34)hPTH
(n=10) for 3 days with single daily injections of either vehicle or
80ng/g-bw h(1-34)PTH. At the end of the 3-day treatment, cortical bone was
isolated as described above and expression of sCSF1 quantified using
isoform-specific primers: F: ccaagaactgcaacaacagc; R: gggtggctttagggtacagg
Statistical Analyses: Statistical analyses were performed using GraphPad
Prism version 5.0c (GraphPad Software Inc., San Diego, CA, USA).
Two-tailed t tests were used where appropriate. A p value <0.05 was
considered significant. Data are presented using bar graphs with standard
errors of the mean.
Figure S1. Baseline BMD Data in SPHK1-Oc-/-. In these 12 week-old male and
female SPHK1-Oc-/- animals there were no significant differences in any
trabecular bone parameters in the femur, spine and cortical bone compared
to controls. (Female control n=9, SPHK1-Oc-/- n=9, male control n=3,
SPHK1-Oc-/- n=7, NS=Not Significant) Figure S2. An anabolic PTH regimen
induces expression of the soluble isoform of CSF1 in cortical bone of
SPHK2-/- mice. Cortical bone was isolated from animals at the end of the
anabolic PTH treatment regimen as described in the Results. Cortical bone
RNA was prepared as described in the Methods and expression of the soluble
isoform of CSF1 (sCSF1) was quantified by qPCR using the primers described
in the Methods. PTH treatment induced significant expression of the
soluble isoform of CSF1 in bone isolated from SPHK2-/- mice. All groups,
n=5. ** p<0.01; unless labelled with an asterisk, the differences
observed were not significant.